Write only at least 3 paragraph talking answer two of the the question from each chapter. Make it short and sweat. I have attached an article down. Chapter 4 Drawing on this chapter please address on
Sorrells, Intercultural Communication, Instructor Resources Chapter 4 (Dis) Placing Culture and Cultural Space: Locations of Nonverbal and Verbal Communication Lecture Notes: Chapter Overview, Objectives and Outline Chapter Overview Expanding on Chapter 3, this chapter shifts our attention outward from the body to explore and “read” the cultural and intercultural communication dimensions of place, space and location. Cultures are simultaneously placed and displaced, inevitably located in specific places and yet, dislocated from their sites of origin in the context of globalization. The confluence of forces that shape the terrain of globalization has dramatically accelerated the displacement and re-placement of people, cultures and cultural spaces since the early 1990s. Given this displacement and fragmentation of cultures, we investigate how human beings use communicative practices to construct, maintain, negotiate, reconstruct and hybridize cultural spaces. Understanding globalization as a legacy of colonization allows us to recognize how cultural spaces experienced today—segregated, contested and hybrid cultural spaces—sustain historically forged relations of unequal power. The concept of glocalization is introduced to focus attention on how specific places are impacted by globalizing and localizing forces. The notion of bifocal vision or the ability to attend to the linkages between “here” and “there” as well as the connections between the present and past is offered to understand the complex, layered and contested dimensions of places, cultural spaces and locations today. Building on the case study introduced in the previous chapter, hip hop culture is used to illustrate the cultural and intercultural dimensions of place, space, and location in the context of globalization. With the globalization of hip hop culture, paradoxical forces emerge shaping intercultural communication. While hip hop culture (culture as a resource) can enable economic mobility and a vehicle of communication for marginalized voices, its counter-hegemonic messages of resistance and struggle are often defused through processes of commodification. Chapter Objectives To understand the relationships among culture, place, cultural space, and identity in the context of globalization. To understand how people use communicative practices to construct, maintain, negotiate, and hybridize cultural spaces To explore how cultures are simultaneously placed and displaced in the global context leading to segregated, contested and hybrid cultural spaces. To introduce the notion of bifocal vision to highlight the linkages between “here” and “there” as well as the connections between present and past. Key Terms *indicated in bold and italicized letters below Cultural space Location of enunciation (Dis) placed cultural spaces De-industrialization Time-space compression Polysemic “In-hereness AND out-thereness” Appropriation Glocalization Segregated cultural space Avowed identity Contested cultural space Ascribed identity Hybrid cultural space Hybrid cultural space as site of intercultural negotiation Hybrid cultural space as site of resistance Hybrid cultural space as site of transformation Introduction We now move outward from the body (chapter 3) to explore and “read” the cultural and intercultural communication dimensions of place, space and location. In this chapter, we examine the dynamic process of placing and displacing cultural space in the context of globalization. We investigate how human beings use communicative practices to construct, maintain, negotiate, reconstruct and hybridize cultural spaces. We look at how segregated, contested, and hybrid cultural spaces are both shaped by the legacy of colonialism and in the context of globalization. Hip hop culture is used to illustrate the cultural and intercultural dimensions of place, space, and location in the context of globalization. Textbox: Communicative Practices: Space and Cultural Differences The textbox provides a narrative example of cultural differences in how people use and interact with private space. A South Korean international student visits her professor’s house and is given a house tour. She is confused about how American people show the entire house to their guests. Placing Culture and Cultural Space Historically, notions of culture have been closely bound to place, geographic location, and the creation of collective and shared cultural spaces. The traditional anthropological definition of culture implies culture as grounded and bounded in place. A reciprocal relationship exists between culture and place. In the context of globalization, culture and cultural spaces have been de-territorialized, removed from their original locations and re-territorialized or re-situated in new locations. Cultural Space Cultural space: The communicative practices that construct meanings in, through and about particular places. Cultural space shapes verbal and nonverbal communicative practices. i.e. Classrooms, club, library. Cultural spaces are constructed through the communicative practices developed and lived by people in particular places. Communicative practices include: The languages, accents, slang, dress, artifacts, architectural design, the behaviors and patterns of interaction, the stories, the discourses and histories. Places and the cultural spaces that are constructed in particular locations also give rise to collective and individual identities. Place, Cultural Space and Identity Stereotypes, assumptions, and judgments are associated with cities, towns, and neighborhoods. People use cultural space to create avowed and ascribed identities. Avowed Identity: The way we see, label and make meaning about ourselves. Ascribed Identity: The way others may view, name and describe us and our group. Geographical locations intersect with social locations (i.e. race, class, gender) to create locations of enunciation. Locations of enunciation: Sites or positions from which to speak. A platform from which to voice a perspective and be heard and/or silenced. Questions to consider: How are differences in terms of race and class mapped onto geographic locations? How do these mappings shape locations of enunciation? How are cultural spaces gendered and how does gender impact locations of enunciation? Textbox: Cultural Identity: Views on “Home” and Identity The textbox provides contrasting narratives of two young women who negotiate their identities and senses of home across places. As a Japanese American woman, Monica struggles with how people perceive her as a foreigner. As a Japanese woman, Sayaka struggles with how American people reduce her into a representative of all things Japanese. Displacing Culture and Cultural Space In the context of globalization, culture travels across places and are re-placed in new environments. (Dis) placed culture and cultural space: A notion that captures the complex, contradictory and contested nature of cultural space and the relationship between culture and place that has emerged in the context of globalization. Time-space Compression: A characteristic of globalization that brings seemingly disparate cultures into closer proximity, intersection and juxtaposition with each other (Havey, 1990). Glocalization: “In here-ness” AND “Out there-ness” “In-hereness AND out-thereness”: A characteristic of globalization in which a particular “here” is linked to “there,” and how this linkage of places reveals colonial histories and postcolonial realities. We need to investigate how this particular “here” is linked to “there” and how this linkage of places reveals colonial histories and postcolonial realities. Glocalization: The dual and simultaneous forces of globalization and localization. First introduced in 1980s to describe Japanese business practices Later popularized by sociologist Roland Robertson (1991). The concept allows us to think about how globalizing forces always operate in relationship to localizing forces. In order to understand the intercultural dynamics occurring in cultural spaces around us, we need to examine the histories of interaction that literally and figuratively shape and construct meanings about the ground upon which we stand today. Example: Los Angeles has a mixture of ethnic communities today. The land was first occupied by indigenous American Indians, which was invaded by the Spanish, inhabited by Mexicans, and taken over by White Americans and other racial groups. “We are here because you were there.” Case Study: Hip Hop Culture South Bronx Hip Hop culture emerged out of the harsh, burned-out, poverty-stricken, gang dominated urban spaces of the South Bronx. Black and Puerto Rican youth took what was available to them—their bodies, their cultural forms of expression and their innovation—to reclaim their “place.” Through creative forms of cultural expression with deep ancestral ties such as breakdancing, graffiti, and rap music, the South Bronx was transformed into a site of pleasure and protest. The youth of the South Bronx used the streets, parks, subways, abandoned buildings, and trains as locations for creating, writing and voicing their own “texts” about their struggles. De-industrialization: A process of economic globalization in which manufacturing jobs are lost to cheaper and less regulated labor conditions outside of the U.S. New York City was affected by de-industrialization in the 1970s, causing joblessness, slum landlords, economic divestment and de-population. Out of these conditions, hip hop culture rose as a vibrant, expressive, and oppositional urban youth culture. Back in the Day From the beginning, the communicative practices of hip hop culture developed in relationship to particular places, an identification with and defense of territory and an awareness of socio-political locations. Examples: “Tagging”—the marking of either your own territory to signify authority and dominance or the marking of others’ territory to provoke—morphed into graffiti “writing,” where individual and group “writers” used the city as their canvas. Going Commercial As hip hop commercialized and “went national” in the late 1980, the regional place-based split between the East and West Coasts gained prominence. The rise of hip hop culture on the West Coast was “an attempt to figure Los Angeles on the map of hip hop” in a direct communicative “reply to the construction of the South Bronx/Queensbridge nexus in New York” (Cross, 1992, p. 37). The commercial success of rap has led to artist-owned businesses and independent labels providing employment and economic viability for many African Americans. Hip hop is a highly contested cultural space. Mainstream middle and upper class Whites and Blacks decry the corrosive moral effects of hip hop culture. The vibrant lyrics of rap and the locations of enunciation pictured and voiced in music videos capture the attention of youth across the U.S. and the globe. Fascinated and lured by narratives of rebellion, oppositional identities and locations on the margin, youth of all ethnic racial backgrounds and particularly White Americans are the primary consumers. Global Hip Hop Culture Today, hip hop cultural spaces are materializing around the globe. In urban, suburban and rural settings in Europe, Africa, Latin America and Asia, hip hop culture has been de-territorialized from the urban centers of the U.S. and re-territorialized in new locations creating hybrid cultural spaces that illustrate processes of glocalization. While the communicative practices of hip hop cultures around the world are clearly linked to the African diasporic colonial experience, they also re-work the qualities of flow, layering and rupture in their place-based specificity as global forces converge with local forces. Example: Hip hop culture and styles developed in France and Italy provide spaces to address local issues of racism and concerns over police brutality. In Sweden, the hip hop scene among ethnic minorities focuses on constructing a collective oppositional identity to resist the White skin-head youth culture. For Maoris in New Zealand, rap music groups speak out for the rights of indigenous groups around the world. Hip hop in Japan is often used as a means of identity distinction by youth who want to mark themselves as different from the mainstream culture. Appropriation: “Borrowing,” “mishandling,” and/or “stealing.” It raises questions about authenticity, ownership and relations of power. Is hip hop essentially a Black thing? Is appropriation of hip hop culture by other cultures problematic? “Black” culture becomes global culture as hip hop is de-territorialized and re-territorialized around the globe and the music and styles mesh with and call forth local responses. Hip hop culture has paradoxical forces in shaping intercultural communication. It enables economic mobility and provides a platform for speaking. It also promotes stereotypes about communities of color and valorizes danger, violence, misogyny and homophobia. It provides communication vehicles for the marginalized. It also promotes commodification of culture and benefits those who control the music industries, primarily White Americans. Cultural Space, Power and Communication Throughout history and today, space has been used to establish, exert and maintain power and control. Power is signified, constructed and regulated through size, shape, access, containment and segregation of space. The use of space communicates. Example: In the Middle Ages in Europe, churches were the tallest buildings and occupied central locations in cities signifying the importance of religious authority. Example: In the Ottoman Empire, no building was built higher than the minarets of mosques. Example: European colonizers erected churches on top of local religious sites from the Americas to India and Africa to materially and symbolically impose colonial rule. Today, the signs of power in metropolises around the world are the financial buildings—the towering, glitzy, eye-catching economic centers of transnational capitalism. Edward T. Hall (1966) elaborated in his book The Hidden Dimension, the way cultures use space communicates. Segregated Cultural Space Segregated space based on socio-economic, racial, ethnic, sexual, political and religious differences, both voluntary and imposed. Minority cultural groups may choose to live in communities in close proximity as a way to reinforce and maintain cultural spaces and to buffer themselves from real or perceived hostile forces around them. These cultural spaces often provide and reinforce a sense of belonging, identification and empowerment. Yet, many historical and contemporary examples illustrate how spatial segregation has been imposed and is used to establish and maintain the hegemony of the dominant group and to restrict and control access of non-dominant groups to power and resources. Example” The word “ghetto,” used primarily today to refer to ethnic or racial neighborhoods of urban poverty, originally referred to an area in Venice, Italy where Jews were segregated and required to live in the 1500s. Example: The reservation system imposed on Native Americans, the Jim Crow laws (1865-1960s) that segregated Blacks and the isolation of Japanese Americans during WWII are examples of forced segregation that maintained the hegemony of European Americans and limited access for non-dominant groups in the U.S. Example: Sundown towns or “whites only” towns, named for their threats of violence aimed at Blacks after the sun sets, are places that have deliberately excluded Blacks for decades and which, today, increasingly exclude Latinos. Example: Schools today are re-segregated to the same level as in 1970s according to a clear racial and class line. Example: In Hurricane Katrina, while all people living in New Orleans and the Gulf area were impacted by the natural disaster, low-income, working class neighborhoods were hit the hardest. Segregation of cultural spaces structure and reinforce different power positions within socio-economic, political and cultural hierarchies. Segregation, whether it is class, race, gender-based or an intersection of all three is a powerful means to control, limit and contain non-dominant groups. Contested Cultural Space Geographic locations where conflicts engage people with unequal control and access to resources in oppositional and confrontational strategies of resistance. Example: Chinese immigrants who came to the U.S. to work from the 1850s onward were forced to live in isolated ethnic enclaves known as Chinatowns in large cities such as San Francisco and New York. This is where the stereotypical image of Chinese restaurants and laundry shops, Japanese gardeners and produce stands, and Korean grocery stores began. These (occupations) did not begin out of any natural or instinctual desire on the part of Asian workers, but as a response to prejudice, exclusion, and institutional discrimination— a situation that still continues in many respects today. Example: After the devastating 1906 earthquake and fires in San Francisco, White city leaders and landlords wanted to re-locate Chinatown to the outskirts of town claiming that it was an “eyesore and health hazard. A political battle ensued with the Chinese community leaders strongly protesting the forced displacement. Finally, they were able to convince the White civic leaders that Chinatown could be re-built in a “traditional Oriental” style to attract tourists and contribute to the city’s revenue and appeal. Polysemic: A condition in which multiple meanings are constructed about certain place, people and phenomena. Chinatown is a polysemic space with multiple meanings. Chinatown was originally a place of ethnic exclusion, a home to Asian immigrants, and then it became cultural resource, and a tourist attraction and commodity. Example: In the early 2000s, in Hudson, New York, a small town of 7,000 just 100 miles north of New York City, residents joined together in what has been described as a lopsided power battle between David and Goliath. The largest cement company in the world, Swiss-owned Holderbank, planned to build a massive, coal-fired cement manufacturing factory nearby Hudson on the banks of the river. Competing concerns and interests—the lure of job opportunities, detrimental environmental effects and political affiliations—divided residents across lines of race, gender and sexual orientation. “Spaces are contested precisely because they concretize the fundamental and recurring, but otherwise unexamined, ideological and social frameworks that structure practice” (Low & Lawrence-Zúñiga, 2003, p. 18). Contested cultural spaces like hip hop culture expose how socially constructed ideological frameworks such as race, class and gender function to divide, segregate and exclude. Hybrid Cultural Spaces The intersection of intercultural communication practices that construct meanings in, through and about particular places within a context of relations of power. The following three examples of hybrid cultural spaces help us understand the power dynamics that structure the terms and conditions of mixing in hybrid cultural spaces. Example: Imagine you are sitting in a McDonald’s in Moscow, Russia. You might expect to find a situation similar to what you experience here in the U.S.—a fast, inexpensive, (fat) filling meal in a familiar and standardized space (each one is pretty much like the next one) where you either sit down, eat your meal and leave or take the drive-through option. You might assume you will have an experience of “American” culture in Russia. Yet, when Shannon Peters Talbot (as cited in Nederveen Pieterse, 2004, p. 50) conducted an ethnographic study of McDonald’s in Moscow, Russia, she found something quite different. Moscowites came to McDonald’s to enjoy the atmosphere often hanging out for more than an hour. They pay more than one third of the average Russian daily wage for a meal and are drawn to this cultural space for its uniqueness and difference. Instead of “one size fits all” management practices that are generally applied in the U.S., McDonald’s in Moscow offers a variety of incentive options for employees The proliferation of multinational entities around the globe suggests a corporatization and homogenization of cultural spaces. This McDonaldization of the world (think 16,000 Starbucks in 50 countries, 8,500 Wal-Mart stores in 15 countries outside the U.S., 31,000 McDonald’s in 119 countries, etc.) is the result of unequal power relations, which manifests in an asymmetrical global flow of cultural products. Undoubtedly, this is an example of cultural imperialism or the domination of one culture over others through cultural forms such as pop culture, media, and cultural products. Without erasing the asymmetrical power relations and the dominance of U.S and Western cultural forms, it is important to note the hybrid nature of the cultural space—the mixing of cultural influences, the altered way the space is used, and the new meanings that are produced about the space—in this re-territorialized McDonald’s Hybrid cultural space as site of intercultural negotiation Hybrid cultural spaces as innovative and creative spaces where people constantly adapt to, negotiate with and improvise between multiple cultural frameworks. Communication scholar Radha Hegde (2002) describes the hybrid cultural space in an Asian Indian immigrant home. Multiple cultural practices—food, music, scent, sports, and languages—shape the cultural space of immigrants. Hegde argues that the hybrid cultural space described above is constructed by Asian Indian immigrants as a response to what Salome Rushdie (1991) calls the triple dislocation: a disruption of historical roots, language and social conventions. This triple dislocation penetrates to the very core of migrants’ experiences of identity, social connections and culture. The construction of hybrid cultural spaces, then, is an active and creative effort to maintain and sustain one’s culture in the context of global displacement and re-placement. Hybrid cultural space as site of resistance Hybrid cultural spaces where people challenge stable, territorial, and static definitions of culture, cultural spaces and cultural identities. Constructed in the context of differential power relations, hybrid cultural spaces are forms of resistance to full assimilation into the dominant culture. Hybrid cultural spaces are both highly innovative, improvisational and creative and “also cultures that develop and survive as a form of collective resistance” (Hegde, 2002, p. 261). Hybridity—hybrid cultures, spaces and identities—challenge stable, territorial, and static definitions of culture, cultural spaces and cultural identities. Example: Chicana feminist scholar Gloria Anzaldúa (1987) describes the fluid, contradictory and creative experience of living in the hybrid cultural space she calls the “Borderlands/borderlands.” Amidst the pain, hardship and alienation, Anzaldúa expresses “exhilaration” at living in, speaking from, and continually constructing hybrid cultural spaces—the Borderlands. In the on-going confrontation with and negotiation of “hegemonic structures that constantly ‘marginalize’ the mixtures they create” (Tomlinson, 1999, p. 146), Anzaldúa experiences and constructs a location of enunciation, a position, and a cultural space (both a literal and figurative space) from which to speak and claim an oppositional identity. Nederveen Pieterse (2004) states “…it’s important to note the ways in which hegemony is not merely reproduced but reconfigured in the process of hybridization (p. 74). Hybrid cultural spaces as sites of transformation Hybrid cultural spaces where hegemonic structures are negotiated and reconfigured through hybridization of culture, cultural space, and identity. We have explored segregated, contested and hybrid cultural space through historical and contemporary examples. The discussion of cultural spaces and the excavation of underlying power dynamics here provide a foundation for investigating the intercultural dynamics of border crossing, identity construction, and relationship building in later chapters. Summary Placing Culture and Cultural Space Place, Cultural Space, and Identity Displacing Culture and Cultural Space Case Study: Hip Hop culture Segregated, Contested, and Hybrid cultural space
Write only at least 3 paragraph talking answer two of the the question from each chapter. Make it short and sweat. I have attached an article down. Chapter 4 Drawing on this chapter please address on
Sorrells, Intercultural Communication, Instructor Resources Chapter 7 Privileging Relationships: Intercultural Communication in Interpersonal Contexts Lecture Notes: Chapter Overview, Objectives and Outline Chapter Overview Relationships within families, among friends, with romantic partners and co-workers as well as acquaintances made in schools, service sectors, entertainment and religious groups have become increasingly diverse and multicultural in the age of globalization. Enhanced mobility, economic interdependence, and advances in technology bring people from very diverse cultural, socioeconomic, linguistic and social positions together in unprecedented ways, creating both opportunities and challenges for intercultural relationships In this chapter, relationships are “privileged” in the sense that we foreground interpersonal relationships in our study of intercultural communication. The chapter title, “privileging relationships,” also draws attention to how intercultural relationships in the global context are sites where cultural differences, power, privilege and positionality are negotiated, translated and transformed. The term “intercultural relationships” encompasses a broad and complicated terrain so we begin our discussion by exploring the topography of intercultural relationships. Interracial, interethnic, international and inter-religious or inter-faith relationships are defined and discussed as well as the impact of class differences, sexual orientation and intersecting categories of difference in intercultural relationships. An overview of theories and models that help us understand how intercultural friendships and intimate, romantic relationships are formed and sustained follows. Particular attention is given to how histories of segregation and prejudice influence attitudes about intercultural relationships today. In the context of globalization, advances in technology, particularly expanded access to the Internet, have dramatically accelerated the likelihood of engaging in intercultural interpersonal relationships through computer mediated communication (CMC). The impact of computer mediated communication, specifically the Internet, on intercultural relationships is then addressed. A central goal of this chapter is to understand the critical role intercultural relationships can play in improving intercultural communication, challenging prejudices and stereotypes held by individuals and communities, and building alliances that advance social justice. Chapter Objectives To understand the challenges and opportunities of intercultural interpersonal relationships in the global context. To examine how difference, power, privilege and positionality are negotiated and transformed in intercultural relationships. To understand the impact of exclusion, prejudice and myths on intercultural relationships historically and today. To explore intercultural relationships as potential sites of alliances for social justice in the global context. Key Terms *indicated in bold and italicized letters below Miscegenation Intercultural friendship development process Antimiscegenation initial encounter phase Intercultural relationship exploratory interactional phase Interracial relationship on-going involvement phase Interethnic relationship Relational identity/culture Ethnicity International relationship Four stages of intercultural romantic relationship Inter-religious relationship Stage 1: Racial/cultural awareness Class differences in relationships Stage 2: Coping Class prejudice Stage 3: Identity emergence Classism Stage 4: Relational maintenance Sexuality in relationships Flaming Heterosexism Fetish Heteronormativity Intercultural ally Intercultural alliance Intercultural bridgework Introduction Relationships within families, among friends, with romantic partners and co-workers, etc. have become increasingly diverse and multicultural in the age of globalization. Enhanced mobility, economic interdependence, and advances in technology create both opportunities and challenges for intercultural relationships. Globalizing forces have magnified the frequency and intensity of intercultural relationships. Intercultural relationships in the context of globalization are deeply embedded in the history of colonization as well as the anti-colonial and Civil Rights movements of the second half of the twentieth century. Miscegenation: Refer to “mixed-race” relationships, specifically intermarriage, cohabitation and sexual relationships between people of different races. Antimiscegenation laws: Laws that prohibited marriage between people of different racial groups, existed in over 40 states until 1967 when the laws were overturned in the landmark Loving v. Virginia Supreme Court case. Interracial relationships are on the rise today, but there are stereotypes, myths, and prejudices associated with interracial relationships. Topography of Intercultural Relationships Interracial Intercultural Relationships Interracial relationships are relationships that cross socially constructed racial groups. Example: A friendship or romantic relationship between a Black person and a White person. Example: Relationship between Asian and Native American people. Historically, interactions between different racial groups in the U.S. and particularly between Blacks and Whites were vigorously discouraged, curtailed and in many cases prohibited by law. Because race is a social construct and its meaning varies across places, the impact of race on the formation and maintenance of intercultural relationships varies in different locations around the globe. Example: The experiences of an interracial couple composed of a Black or African American man and a Japanese woman who is racially constructed as Asian are likely to be different if the couple lives in the U.S. than if they live in Japan. Interethnic Intercultural Relationships Interethnic relationships are relationships between people who identify differently in terms of ethnicity or ethnic background. Example: A relationship between an Italian American and Irish American Example: A relationship between a Filipino American and Chinese American Example: Between a Serbian and Croatian in the former Yugoslavia People in interethnic relationships can belong to the same racial group. Ethnicity refers to shared heritage, place of origin, identity and patterns of communication among a group. Ethnic differences among European Americans have been blurred into a racial category. People who avow or are ascribed an identity as White do have an ethnicity. Ethnicity, as it is both distinct from and combines with race, plays a role in choices that are made regarding who develops and sustains friendships and romantic relationships. International Intercultural Relationships International relationships refer to relationships that develop across national cultural and citizenship lines. Example: A relationship between someone who is from Turkey and someone who is from Germany or between someone who is Brazilian and a U.S. American. Many international relationships are also interracial and/or interethnic. International intercultural relationships enrich the lives of both partners through exposure and experience of multiple countries, languages and cultures. International intercultural romantic, long-term relationships are often challenged by questions of where to live, legal rights of citizenship and power imbalances if one partner is perpetually perceived as a “foreigner.” International intercultural relationships partners may confront differences in access to social and institutional power and assumptions of superiority (or inferiority) based on perceptions about countries of origin and race from the social networks surrounding the friends or partners. Inter-religious Intercultural Relationships Inter-religious or inter-faith relationships refer to relationships where people from two different religious orientations or faiths. Example: Judaism, Buddhism, Christianity and Hinduism or Catholic Christians and Protestant Christians form interpersonal relations. Changes in immigration laws within the U.S. since the 1965 Immigration and Naturalization Act and the forces of globalization have brought large numbers of practicing Buddhists, Muslims, Sikhs, and Hindus to the U.S. Christian immigrants from developing countries outnumber immigrants of other religious traditions with two-thirds of all new immigrants being Christian. Research based on a survey of 35,000 Americans found that 37 % of adults in the U.S. are involved in inter-religious or inter-denominational marriages It also suggests that interfaith marriages are correlated with less religious participation and higher divorce rates than same-faith marriages. Children of interfaith relationships can catalyze religious pluralism. Class Differences in Intercultural Relationships Differences in class culture also impact intercultural relationships. Class culture is a significant dimension of intercultural relationships (i.e. where one chooses to eat, hang out and socialize, manners learned as appropriate in given settings, versions of the language spoken at home, and what is expected in the university classroom). Class also affects meanings and attitudes attributed to public displays of wealth as well as norms of raising children. Class culture translates into the social capital to which one has access and manifests in our everyday lives in terms of our habitus—our patterns of perceptions, actions, sensibilities and tastes (Bourdieu, 1984). Class differences manifest in forms of nonverbal communication such as proxemics—the use of space—and fashion. Class prejudice: Personal attitudes individuals of any class culture may hold about members of other classes. Classism: The systemic subordination of class groups by the dominant, privileged class. Sexuality in Intercultural Relationships Issues of sexual orientation in society and in interpersonal relationships are often experienced as either completely invisible or hypervisible. Sexuality is generally unquestioned and heterosexuality is assumed. When an individual or couple challenge the dominant norms of heterosexuality—in terms of gender norms, same-sex affection or attraction—then their sexuality is marked, underscored and made highly visible. Heteronormativity: The institutionalization of heterosexuality in society. The assumption that heterosexuality is the only normal, natural and universal form of sexuality. Heterosexism: An ideological system that denies and denigrates any nonheterosexual behavior, identity or community. Heterosexism not only entails individual biased attitudes but refers to the coupling of prejudicial beliefs with institutional power to enact systemic discrimination. Example: International lesbian or gay couples, who may experience homophobia on a daily basis, are also systematically excluded from marriage in most states in the U.S. and therefore, do not have access to spousal petitions for citizenship. Multidimensional Cultural Differences in Intercultural Relationships Intercultural relationships can and often do involve multiple and intersecting ethnic, racial, national, religious, class and sexual orientation differences. Various geographic, cultural and national landscapes, institutional and individual racism, exclusion and differences in their access to power and privilege may test their relationship. Children of intercultural, interracial, interethnic and inter-religious marriages are faced with both challenges and rewards as they cross, blend and blur cultural, linguistic, national and religious boundaries. Textbox 1: : Cultural Identity: Intercultural Relationships The textbox discusses an interracial and international relationship between a woman from Malaysia and an African American man from Georgia. Interpersonal relationships between people of different racial, ethnic, religious, national, class and sexuality groups take place within historical, cultural, and political contexts which are instrumental in how we interpret and make sense of them. Intercultural interpersonal relationships become sites where we develop and communicate shared and contested meanings of our identities, our sense of belonging to and exclusion from groups. We also learn through our communication how we are positioned in relation to others. Forming and Sustaining Intercultural Relationships Cultural Notions of Friendship The concept of friendships as “chosen relationships” assumes a typically Western, individualistic orientation to friendship. In more group-oriented or collectivist cultures, friendships are often recognized as growing out of group associations, longer term connections to place, community and a sense of mutual obligation. Collier’s (1991) research on African American, Latino/a and European American students found that for all groups the notion of friendship revolved around qualities of trust and acceptance. While European Americans reported that close friendships developed in a few months, Asian Americans, African Americans and Latino/as report taking approximately a year for close friendships to develop. Morality and cultural respect are important for Latino/as. Family is critical for Asian Americans. African Americans focus on pride in ethnic heritage. Krumrey-Fulks’ (2001) research comparing Chinese and American expectations of friendship. Chinese participants viewed friends as those who provided help or assistance. American’s tended to look towards friends as good listeners. Notions of what constitutes a friend, what behaviors are appropriate and what we expect to share in friendship relationships are shaped by the various age, gender, ethnic, racial, cultural, class, and national groups. Intercultural Relationship Development Processes Initial encounter phase, In the initial encounter phase, people who initiate intercultural relationships are drawn to each other based on Proximity to each other Similarities in interests, values and goals as well as cultural, racial and socio-economic backgrounds The ways in which the two complement and are different from each other Physical attraction to one another. In the initial phase of intercultural relationship development, it is important to challenge preconceived assumptions, stereotypes and prejudices regarding racial, cultural and ethnic differences. We need to acknowledge, seek to understand and learn from the differences in communication styles, interactional patterns and cultural, racial and ethnic histories that do exist. Communication scholar Rona Halualani and her colleagues (2004) found that in a context that promotes diversity, students have relatively limited intercultural interaction. The study suggests that people from different ethnic/racial groups may utilize “different sense-making logics” when engaging interculturally. For example, African Americans/Blacks may view intercultural interactions as a site of differentiation where cultural distinction and uniqueness is emphasized. Asian Americans, Latino/as and Whites/European Americans may interact interculturally using a logic of similarities stressing sameness in the encounter. Exploratory interactional phase Intercultural relationships move towards greater sharing of information, increased levels of support and connection and growing intimacy. A significant challenge for intercultural friendship relationships at this stage is the different culturally coded ways in which individuals from different groups have been socialized to achieve support, connection and intimacy. International students in the U.S. frequently comment on the ease with which U.S. Americans share and self-disclose personal information about themselves. Confusion often arises as international students in the U.S. are unsure how to make sense of high levels of self-disclosure, which are sometimes mistaken for increased intimacy and closeness, signaling a movement towards a deeper friendship. Those who are accustomed to a more rapid pace and higher degrees of self-disclosure, often common in the U.S., may find the lack of reciprocal disclosure from their relational partner off-putting and unrewarding. Textbox 2: Intercultural Praxis The textbox discusses how intercultural praxis can be used to navigate the challenges of intercultural relationships. On-going involvement phase. Marked by greater connection, intimacy, involvement, shared rules of engagement, and norms that guide interaction with each other. Marked by a turning point which promotes greater connection, intimacy and involvement between the relational partners (i.e. meeting family members, taking a trip together, greater self-disclosure). Relational identity/culture: The system of understanding that is developed between relational partners as they coordinate attitudes, actions and identities within the relationship and with the world outside the relationship. Intercultural relationships involve the constant and on-going negotiation of both the friendship relational identity and cultural identity. Intercultural Romantic Relationships Even though legal barriers to integration and laws prohibiting intermarriage are relics of the past, borders between ethnic, racial, cultural, religious, and class groups still remain. Opposition to intercultural marriage may not only reflect bigotry but also fears about the loss of long-held cultural traditions, histories and norms as well as concerns about the challenges children and grandchildren may face. The way interracial couples are treated in society tells us a lot about the construction or elimination of racial borders. Intercultural Romantic Relationships Development Myths that have informed research, societal perceptions and media representations regarding interracial couples. Black people have an extraordinarily potent sex drive. Blacks marry Whites for status, a type of socio-economic trade-off. Whites choose Black partners out of rebellion, spite for their parents or as an effort to act out. The genetic inferiority of children from interracial marriages and the psychological problems, particularly in terms of identity, of bi or multiracial children (Stonequist, 1937). Recent research advances a more positive interpretation of bi-racial individuals highlighting their receptivity and adaptability to multiple cultures (Stephan & Stephan, 1991). While bi-racial and bi-cultural people are often challenged by society’s obsessive need to categorize them and may experience marginalization in both ethnic/racial/cultural groups, bi and multicultural people use their ambiguous positionalities in constructive and creative ways. Four-stage model for interracial romantic relationships: Racial/cultural awareness The first stage of intercultural romantic relationship in which partners develop awareness of similarities and differences as well as how they are viewed by others. Coping The second stage of intercultural romantic relationship in which couples develop proactive and reactive strategies to manage challenges. Identity emergence The third stage of intercultural romantic relationship in which couples take charge of the images of themselves, challenge negative societal forces, and reframe their relationship. Relational maintenance. The fourth stage of intercultural romantic relationship in which couples negotiate racial, cultural, ethnic, class and religious differences between themselves and with the society at large. Cyberspace and Intercultural Relationships In the context of globalization, advances in technology, particularly expanded access to the Internet, have dramatically accelerated the likelihood of engaging in intercultural interpersonal relationships through computer mediated communication (CMC). The disparity between those who have access to the internet and those who do not still exist nationally and globally. CMC presents both benefits and challenges to intercultural relationships. Flaming: Abrasive, impulsive or abusive behavior online. Example: African Americans have experienced comments and postings from European Americans in online conversations that are culturally ignorant or racist. Three categories of interracial websites: Sites related to multiracial organizations/support. i.e. Multiracial organizations that celebrate interracial relationships, provide information about issues for bi and multiracial individuals and couples. Interracial dating sites and pornography sites. Offer opportunities to meet partners or find love across color lines are on the rise. They often assume colorblind society and yet play upon racial and cultural stereotypes. Example: mail-order brides, Asian women as “oriental dolls,” or women as commodities. Individual choices are interconnected to the larger relations of power, shaped by stereotypes, racist assumptions, and the first world-third world dynamics. In the Internet pornography industry, interracial sex is often turned into a fetish, a spectacle that is represented as a commodity that is sought after, purchased and consumed. Example: Stereotype of hypersexuality of Black men and women, Black men are out to steal White men’s wives, or White women are either sluts or innocent, pure girls seduced by men of color and that Black women are erotic, sexual objects for White men. Websites of hate groups. The Internet has played a significant role in expanding the accessibility and networking of White supremacist groups in the U.S. Interracial sexuality is presented as a threat to Whiteness, White identity and White power and biracial children are seen as destroying Whites and White culture. The White supremacist websites promoting ideas that interracial relationships are deviant, unnatural and destructive are extreme; yet, Childs (2005) argues these ideas are similar to and extensions of comments, beliefs and ideologies she found in her research of White communities. Intercultural Alliances for Social Justice in the Global Context Intercultural friendships and intimate relationships can play a critical role in improving intercultural communication, challenging prejudices and stereotypes, developing allies and building alliances that advance social justice. An ally is a supporter or partner who can be counted on to work in collaboration with another person, group or community towards a common goal. An intercultural ally: A person, group or community who works across lines or borders of nationality, culture, ethnicity, race, gender, class, religion or sexual orientation in support of and partnership with others. Intercultural alliance: Relationships in which parties are interdependent, recognize their cultural differences, and work toward similar goals. Developing trust, a sense of interdependence and dialogue, where the space to speak openly and the ability to sit with the pain and difficulties of others, is critical in intercultural alliance building. Intercultural alliances often call on individuals to bridge and translate different cultural standpoints, positionalities, struggles and histories. Intercultural bridgework: Developing sensitivity, understanding and empathy and extending vulnerability to traverse multiple positions, creating points of contact, negotiation and pathways of connection. Intercultural alliance can be a foundation of intercultural praxis toward a more just society. Summary Topography of intercultural relationships Multidimensional cultural differences in Intercultural relationships Forming and sustaining intercultural relationships Cyberspace and intercultural relationships Intercultural Alliances for Social Justice in the Global Context

Hello, The research is about of Autism and how affect their families. economic, phycological and social attach is the document with the questions.
STUDENT NAME ______________________________ COURSE & SECTION ___________ Part 1B: Research Experience For this part of the project, I started researching on the internet with defining my keywords which were _________________, ________________, and _______________. I made sure that the sources I used were reliable. I defined reliable sources by whether: 1. An expert wrote an article for a newspaper, magazine, reputable website with no Google advertisements on it. 2 An expert was quoted in an article that appears in a newspaper, magazine, reputable website, etc. 3. The source contained facts and figures that can be proven.  4. A government website listed statistics or facts from a survey or some kind of research. The first web source I came across was _________________________. I knew this was a reliable source because (pick 1, 2, 3 or 4). This source helped support my essay in the following ways (pick either your problem, solution, or counterargument). _______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________. The next source I used from the internet was _________________________. I knew this was a reliable source because (pick 1, 2, 3 or 4). This source helped support my essay in the following ways (pick either your problem, solution, or counterargument). ________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________. Once I found my Internet sources, I continued building on my research by visiting Plaza College’s virtual library. First I visited the database which was _________________________. I knew this was a reliable source because (pick 1, 2, 3 or 4). This source helped support my essay in the following ways (pick either your problem, solution, or counterargument): ________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ I then visited a second database which was _________________________. I knew this was a reliable source because (pick 1, 2, 3 or 4). This source helped support my essay in the following ways:(pick either your problem, solution, or counterargument). ________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will iden
You are assigned two unknown bacteria.  One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will identify according to the simplified DNA Barcoding steps below.    These two bacteria may or may not be the same, not intentionally assigned one way or the other. You will submit your completed report as the TEXT in email by ‘Reply’ to the ‘Unknown Bacteria” email.  Attachment is NOT acceptable.      Part 1 Bergey’s   Amy’s lab note for Unknown 47 test results is copied below.  Use the tests discussed in BIO 150 Lab and the ‘ID Notes’ to identify Amy’s unknown.  Complete the ID Report below.  Your ID Report should include interpretation of the observations described in Amy’s note; that is, you need to state the meaning of the results in microbiology terms.    Amy’s Unknown 47  Gram staining: appeared pink, rod shape  Colony diameter: about 1-2 mm  FTM: growth throughout  Durham glucose: yellow, bubble in the inverted glass vial  Durham lactose: yellow, bubble in the inverted glass vial  Kligler’s: entire tube turned yellow, yellow butt, yellow slant, medium cracked up, no black color  MSA: red, no growth   Semisolid stab: molds! tube appeared milky?  Gelatin stab: green mold on top of medium, gross!  Citrate test: green  Urease test: no color change  Catalase: bubbles  Endospore staining: red rods  Acid-fast staining: blue rods      Part 2 DNA Barcoding  Follow the following steps to identify your DB unknown.    The sequence of your DB unknown is copied below.    Type pubmed.gov into browser  Click on NCBI, National Center for Biotechnology Information (upper left corner)  Click on BLAST (right hand side, under ‘Popular Resources’)  Click on Nucleotide BLAST (nucleotide > nucleotide)  The page opens up is ‘Standard Nucleotide BLAST’  Enter your sequence to the box ‘Enter Query Sequence’  Leave everything as default (that is, do not change setting)  Scroll down   Click on ‘BLAST’ button on the lower left  Wait for a few seconds  Scroll down to review the results  Answer questions in the ID Report below.    DB#5  AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG  CAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGA  TAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTT  GCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAG  CTGGTCTGAGAGGATGACCAGCAACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG  GGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCNGCGTGTATGAAGAAGGCCTTCGGGTTGT  AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAA  GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGC  GTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTG  ATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCT      ID Report    Your Name –     Part 1 Bergey’s  Amy’s Unknown Number –  _____; Identification –      A. Interpret all of Amy’s Unknown test results listed in Part I above:    B. Stepwise Reasoning: (state your rationale; describe how you identified the unknown, based on what; how the other possibilities are ruled out, etc.  It is very important to systemically eliminate the other possibilities, step by step, dichotomous manner.)    C. One paragraph describing the disease(s) this unknown bacterium may cause:    D. Reference citation: (cite the sources of information)      Part 2 DNA Barcoding  Unknown DB Number –  _____; Identification –      1.    What is the name this unknown bacterium according to the NCBI BLAST sequence analysis?    2.    Can the bacterium of the unknown DB# _____ possibly be the same bacterium as Amy’s unknown # _____?    3.    Name two test results (any two among the ones discussed in our BIO 150 Lab) that can support your answer to (1).  Name another two test results that can support your answer to (2).     

Question 12 PointsWhat type of JOIN returns all rows from the first table and any matching rows from the second table? FULL OUTER JOIN LEFT OUTER JOIN INNER JOIN RIGHT OUTER JOIN Question 22 PointsWhi
12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 1/12 Question 1 2 Points What type of JOIN returns all rows from the first table and any matching rows from the second table? FULL OUTER JOIN LEFT OUTER JOIN INNER JOIN RIGHT OUTER JOIN Question 2 2 Points Which records will the following FROM clause select? FROM Faculty LEFT JOIN Classes All Faculty records and any Class records that are related to them Any Class records that are related to Faculty records All Class records and any Faculty records that are related to them Any Faculty records that are related to Class records Question 3 2 Points When testing for NULL values to find Customers who have no Orders, which column is best to include in the WHERE clause below: WHERE __________ IS NULL Any foreign key from the Customers table The primary key from the Customers table The OrderDate column from the Orders table The primary key from the Orders table 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 2/12 Question 4 2 Points What type of JOIN returns all rows from the second table and any matching rows from the first table? RIGHT OUTER JOIN FULL OUTER JOIN INNER JOIN LEFT OUTER JOIN Question 5 2 Points What clause can be placed after the UNION keyword to indicate that you want the UNION performed by comparing columns that have the same name in each result set? GROUP BY CORRESPONDING HAVING WHERE Question 6 2 Points Where is the ORDER BY clause placed to sort the results of a UNION? The results of a UNION cannot be sorted At the end of each SELECT statement At the end of the last SELECT statement At the end of the first SELECT statement Question 7 2 Points 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 3/12 When the _________ keyword is left out of a UNION, the database system automatically eliminates any duplicate rows. EXCEPT ANY ALL DISTINCT Question 8 2 Points Which of the following is a requirement for the columns of the SELECT statements in a UNION? Must have the same number of output columns specified. Neither of these are requirements. Each corresponding column must have a comparable value. Both of these are requirements. Question 9 2 Points A SELECT expression that is embedded within one of the clauses of a SELECT statement is a(n) ____________. embedded SELECT sub-SELECT embedded query subquery Question 10 2 Points Which of the following is a request that can be answered using a subquery? Create a list that combines agents and entertainers. 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 4/12 Create an index list of all the recipe classes, recipe titles, and ingredients. Display products and the latest date the product was ordered. Show me the students who have a grade of 85 or better in Art together with the faculty members who teach Art and have a proficiency rating of 9 or better . Question 11 2 Points What type of subquery is an embedded SELECT expression that returns only one column and no more than one row? Table subquery Row subquery Scalar subquery Question 12 2 Points Which aggregate function calculates the mean for a value expression? MAX(value expression) MIN(value expression) SUM(value expression) A VG(value expression) Question 13 2 Points When an aggregate function is used as a search condition it must be placed in (a) __________. brackets [] subquery parentheses () braces {} 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 5/12 Question 14 2 Points When using an aggregate function, what is the name of the column in the final result set? The name is generated by the database system. The name assigned in the AS clause. None of these are possible names for the column. All of these are possible names for the column. The column has no name. Question 15 2 Points What character is used to separate the columns referenced in the GROUP BY clause? Comma , Period . Colon : Semicolon ; Question 16 2 Points Which clause is used to group matching values of a specified column together? WHERE GROUP BY FROM HAVING SELECT 2Points 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 6/12 Question 17 2 Points When the GROUP BY clause is used without aggregate functions it will give you the same result as what keyword? DISTINCT HAVING WHERE FROM Question 18 2 Points Columns referenced in the WHERE clause must be a part of what? The columns referenced in the ORDER BY clause. Tables defined in the FROM clause. The columns referenced in the SELECT clause. The columns used in aggregate functions. Question 19 2 Points Columns referenced in the HA VING clause must also be referenced where? Enclosed within an aggregate function Neither in the GROUP BY clause nor enclosed within an aggregate function In the GROUP BY clause Either in the GROUP BY clause or enclosed within an aggregate function Question 20 2 Points When does the WHERE clause act on rows? 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 7/12 After the rows have been grouped Before the rows are grouped During the grouping of rows Question 21 2 Points What SQL feature enables you to undo a series of changes to the data? System Updates UPDATE Undo Transactions UPDA TE statements Question 22 2 Points What character is used to separate multiple assignment statements in the SET clause? Colon : Semicolon ; Comma , Period . Question 23 2 Points What need would NOT be addressed with an UPDA TE statement? Increasing the price of all sports supplements by 3% Creating a list of all supplements that contain Creatine by manufacturer Appending the word ?powder? to all ItemDescriptions for MuscleMilk products Changing the category of all sports supplements to ?Nutrition? 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 8/12 Question 24 2 Points If the new value of a column involves the old or current value of the column, the column must be referenced where? The left side of the equal sign The UPDA TE clause The WHERE clause Both sides of the equal sign Question 25 2 Points Data can be inserted into a table or what other database item? View Report Function Stored procedure Question 26 2 Points When the INSER T statement is fetching rows of data to be placed into a table, the SELECT expression is used in place of what? The VALUES clause The value expression The column name list The table name Question 27 2 Points 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 9/12 In an INSER T statement, the column name list can be omitted if you are doing what? Adding only a NULL value Adding only a default value Adding data only to the primary key column Supplying a value for every column in the table Question 28 2 Points Which clause is used to limit the rows deleted in the DELETE statement? DELETE HAVING WHERE FROM Question 29 2 Points What would keep the DELETE statement without the WHERE clause from deleting all the rows in a table? System logs Referential integrity constraints Transactions Question 30 2 Points What is a possible method for ensuring that the correct rows are deleted from the database before the DELETE statement is run? Using transactions Creating a SELECT statement and then transferring the WHERE clause to the DELETE statement Using system logs 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 10/12 Question 31 10 Points W e are planning our 1st Quarter marketing budget and need you to provide some historical sales data from the SalesOrdersModify database. Provide summarized data regarding the orders we received during the 1st quarter of 2018 (Jan.-Mar .) broken out by customer city and state. Include customer city and state names along with the count of all orders, the average order total, smallest and largest order totals and the sum of all orders from that city and state. Arrange them by state and then city . Please make sure the average is formatted with two digits after the decimal place. (20 rows) Question 32 10 Points We are planning a postcard mailing to promote our performers who play Show Tunes or Standards. Using the EntertainmentAgencyModify database, list the full name and mailing address for all customers who did not book any performers in 2018 who play Show Tunes or Standards so that we can include them in the mailing. (Hint: create a subquery to list all customers who DID book performers who play those musical styles and then test for NULL to see which customers are not in that list) You must use the names of the musical styles, not the styleID numbers. (7 rows) 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 11/12 Question 33 10 Points Our EntertainmentAgencyModify database is encountering performance issues because of its size. Archive all Engagements that both started and ended prior to March 1, 2018 into the Engagements_Archive table. After archiving the old Engagements, remove them from the original Engagements table to reduce the size of that table. Remember to use transactions for each of these two queries to protect your data. (45 rows) (Note : Refer to the schema in Question 32 for relationships.) Question 34 10 Points We are looking for customer endorsements of the performer “Modern Dance”. Provide a list of names and phone numbers for any customers in the EntertainmentAgencyModify database who have ever booked this performer . Remember that some of these engagements may now be archived. Put the list of customers in alphabetical order by last name and first name. (Hint: use a SQL command that will allow you to combine the results of two similar queries, one for Engagements and one for Engagements_Archive, into a single result set.) (8 rows) 12/6/21, 5:00 PM View Assessment https://blackboard.sacredheart.edu/ultra/courses/_43462_1/outline/assessment/_2466761_1/overview/attempt/_5275671_1?courseId=_43462_1 12/12 (Note : Refer to the schema in Question 32 for relationships.)