You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will iden

Get perfect grades by consistently using our affordable writing services. Place your order and get a quality paper today. Take advantage of our current 20% discount by using the coupon code GET20


Order a Similar Paper Order a Different Paper

You are assigned two unknown bacteria.  One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will identify according to the simplified DNA Barcoding steps below.

These two bacteria may or may not be the same, not intentionally assigned one way or the other. You will submit your completed report as the TEXT in email by ‘Reply’ to the ‘Unknown Bacteria” email.  Attachment is NOT acceptable.

Part 1 Bergey’s

Amy’s lab note for Unknown 47 test results is copied below.

Use the tests discussed in BIO 150 Lab and the ‘ID Notes’ to identify Amy’s unknown.

Complete the ID Report below.  Your ID Report should include interpretation of the observations described in Amy’s note; that is, you need to state the meaning of the results in microbiology terms.

Amy’s Unknown 47

Gram staining: appeared pink, rod shape

Colony diameter: about 1-2 mm

FTM: growth throughout

Durham glucose: yellow, bubble in the inverted glass vial

Durham lactose: yellow, bubble in the inverted glass vial

Kligler’s: entire tube turned yellow, yellow butt, yellow slant, medium cracked up, no black color

MSA: red, no growth

Semisolid stab: molds! tube appeared milky?

Gelatin stab: green mold on top of medium, gross!

Citrate test: green

Urease test: no color change

Catalase: bubbles

Endospore staining: red rods

Acid-fast staining: blue rods

Part 2 DNA Barcoding

Follow the following steps to identify your DB unknown.

The sequence of your DB unknown is copied below.

Type pubmed.gov into browser

Click on NCBI, National Center for Biotechnology Information (upper left corner)

Click on BLAST (right hand side, under ‘Popular Resources’)

Click on Nucleotide BLAST (nucleotide > nucleotide)

The page opens up is ‘Standard Nucleotide BLAST’

Enter your sequence to the box ‘Enter Query Sequence’

Leave everything as default (that is, do not change setting)

Scroll down

Click on ‘BLAST’ button on the lower left

Wait for a few seconds

Scroll down to review the results

Answer questions in the ID Report below.

DB#5

AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG

CAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGA

TAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTT

GCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAG

CTGGTCTGAGAGGATGACCAGCAACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG

GGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCNGCGTGTATGAAGAAGGCCTTCGGGTTGT

AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAA

GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGC

GTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTG

ATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCT

ID Report

Your Name –

Part 1 Bergey’s

Amy’s Unknown Number –  _____; Identification –

A. Interpret all of Amy’s Unknown test results listed in Part I above:

B. Stepwise Reasoning: (state your rationale; describe how you identified the unknown, based on what; how the other possibilities are ruled out, etc.  It is very important to systemically eliminate the other possibilities, step by step, dichotomous manner.)

C. One paragraph describing the disease(s) this unknown bacterium may cause:

D. Reference citation: (cite the sources of information)

Part 2 DNA Barcoding

Unknown DB Number –  _____; Identification –

1.    What is the name this unknown bacterium according to the NCBI BLAST sequence analysis?

2.    Can the bacterium of the unknown DB# _____ possibly be the same bacterium as Amy’s unknown # _____?

3.    Name two test results (any two among the ones discussed in our BIO 150 Lab) that can support your answer to (1).  Name another two test results that can support your answer to (2).

You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will iden
You are assigned two unknown bacteria.  One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will identify according to the simplified DNA Barcoding steps below.    These two bacteria may or may not be the same, not intentionally assigned one way or the other. You will submit your completed report as the TEXT in email by ‘Reply’ to the ‘Unknown Bacteria” email.  Attachment is NOT acceptable.      Part 1 Bergey’s   Amy’s lab note for Unknown 47 test results is copied below.  Use the tests discussed in BIO 150 Lab and the ‘ID Notes’ to identify Amy’s unknown.  Complete the ID Report below.  Your ID Report should include interpretation of the observations described in Amy’s note; that is, you need to state the meaning of the results in microbiology terms.    Amy’s Unknown 47  Gram staining: appeared pink, rod shape  Colony diameter: about 1-2 mm  FTM: growth throughout  Durham glucose: yellow, bubble in the inverted glass vial  Durham lactose: yellow, bubble in the inverted glass vial  Kligler’s: entire tube turned yellow, yellow butt, yellow slant, medium cracked up, no black color  MSA: red, no growth   Semisolid stab: molds! tube appeared milky?  Gelatin stab: green mold on top of medium, gross!  Citrate test: green  Urease test: no color change  Catalase: bubbles  Endospore staining: red rods  Acid-fast staining: blue rods      Part 2 DNA Barcoding  Follow the following steps to identify your DB unknown.    The sequence of your DB unknown is copied below.    Type pubmed.gov into browser  Click on NCBI, National Center for Biotechnology Information (upper left corner)  Click on BLAST (right hand side, under ‘Popular Resources’)  Click on Nucleotide BLAST (nucleotide > nucleotide)  The page opens up is ‘Standard Nucleotide BLAST’  Enter your sequence to the box ‘Enter Query Sequence’  Leave everything as default (that is, do not change setting)  Scroll down   Click on ‘BLAST’ button on the lower left  Wait for a few seconds  Scroll down to review the results  Answer questions in the ID Report below.    DB#5  AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG  CAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGA  TAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTT  GCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAG  CTGGTCTGAGAGGATGACCAGCAACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG  GGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCNGCGTGTATGAAGAAGGCCTTCGGGTTGT  AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAA  GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGC  GTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTG  ATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCT      ID Report    Your Name –     Part 1 Bergey’s  Amy’s Unknown Number –  _____; Identification –      A. Interpret all of Amy’s Unknown test results listed in Part I above:    B. Stepwise Reasoning: (state your rationale; describe how you identified the unknown, based on what; how the other possibilities are ruled out, etc.  It is very important to systemically eliminate the other possibilities, step by step, dichotomous manner.)    C. One paragraph describing the disease(s) this unknown bacterium may cause:    D. Reference citation: (cite the sources of information)      Part 2 DNA Barcoding  Unknown DB Number –  _____; Identification –      1.    What is the name this unknown bacterium according to the NCBI BLAST sequence analysis?    2.    Can the bacterium of the unknown DB# _____ possibly be the same bacterium as Amy’s unknown # _____?    3.    Name two test results (any two among the ones discussed in our BIO 150 Lab) that can support your answer to (1).  Name another two test results that can support your answer to (2).     

Have your paper completed by a writing expert today and enjoy posting excellent grades. Place your order in a very easy process. It will take you less than 5 minutes. Click one of the buttons below.


Order a Similar Paper Order a Different Paper